10 Tips For Designing PCR Primers That Work
Since PCR primer design is one of the most widely used features of DNASIS SmartNote, we did some research and put together a list of the top 10 tips for designing PCR primers that work. When designing oligonucleotide primers for PCR, it is helpful to keep some considerations in mind to optimize the output and specificity of your experiment. Here are some tips gathered from experts to get you started:
1. Design your PCR primers to be 18-30 oligo nucleotides in length. The longer end of this range allows higher specificity and gives you space to add restriction enzyme sites to the primer end for cloning.
2. Make sure the melting temperature (Tm) of the primers used are not more than 5°C different from each other. You can calculate Tm with this formula: Tm = 4(G + C) + 2(A + T)°C
3. Aim for a Tm between 65 and 70°C for each primer over the region of hybridization
4. Use an annealing temperature (Ta) of 10 to 15°C lower than the Tm.
5. The GC content of each primer should be in the range of 40-60% for optimum PCR efficiency.
6. Try to have uniform distribution of G and C nucleotides, as clusters of G’s or C’s can cause non-specific priming.
7. Avoid long runs of the same nucleotide.
8. Check that primers are not self-complementary or complementary to the other primer in the reaction mixture, as this will encourage formation of hairpins and primer dimers and will compete with the template for the use of primer and reagent.
9. If you can, make the 3′ end terminate in C or A, as the 3′ is the end which extends and neither the C or A nucleotide wobbles. This will increases the specificity.
10. You can avoid mispriming by making the 3′ end slightly AT rich.
11. Use the right software. OK, so it’s 11 tips. Using the right software is a great way to automate these steps and minimize errors, especially when you have to design primers for many sequences. DNASIS SmartNote includes several primer design tools and is also a lab notebook that automatically keeps a record of your analysis results. You should definitely give it a try. Click here to sign up a free account.
If you prefer traditional desktop software, take a look at DNASIS Max instead.
References:
http://rothlab.ucdavis.edu/protocols/PrimerDesign.html
http://www.biochem.ucl.ac.uk/bsm/nmr/protocols/protocols/oligo.html
http://www.protocol-online.org/prot/Molecular_Biology/PCR/PCR_Primer/
http://www.mcb.uct.ac.za//pcroptim.htm
Thanks for this valuable notes. Is it possible to download a suitable software that commonly used in primers design? if so could you send the site (s).
Reply
admin reply on October 7th, 2008 11:29 am:
Hi Dr. Nazar,
MiraiBio also offers a desktop solution for bioinformatics called DNASIS MAX that is suitable for primer design and even siRNA design. There is a free 31-day trial period and you can find more information on our DNASIS MAX product page.
Reply
Good & informative.
Reply
Hi Doctor
In this case for example could you tell me what is the forward and reverse primer for this part of gene ?my mean is that we are going to design primers to amplify the target region (indicated by the asterisks, *).
***************************************************************
5′ ACTCGACCTTCCACGCACTCTAGCTGACATGCGATGCT………. ……… continued
***************************************************
continued …………CCGATTCGACCGTGGCAATCTCAGCACGGCTAGCTATCGATACGCGGACTCTCA 3′
Thanks
Reply
admin reply on October 27th, 2008 5:27 pm:
Hi Ehsan,
I apologize but the formatting of your sequence is not correct and it is difficult to tell what region you are interested in.
I would recommend that you sign up for a free DNASIS SmartNote account (http://smartnote.miraibio.com/signup.php), upload your sequence, and run the Primer3 tool.
Reply
Thanks for the clear and valuable information. I found it’s really helpful.
Reply
Interesting………….do anyone give trainings in primer designing?????…Pls let me know.Currently,I work to find alkaline phosphatase domains in Cyanobacterium.
Regards
Mohammed Ajeesh C.P
Reply
admin reply on November 10th, 2008 6:26 pm:
Hi Mohammed,
I’m not sure if there is a specific type of training that you are looking for but I would recommend that you use online forums in molecular biology to find the help that you need.
MiraiBio has just started a Community and although it is still new, it may be worth a shot to start a thread on this topic in the DNASIS SmartNote General forum:
http://www.miraibio.com/community/viewforum.php?f=43&sid=fbd4e6e18aebe254d17aabeb8c9bae26
I hope this information helps.
Reply
Im currently using real time pcr to analyse fruit fly samples and wanted to ask if there is a known universal temperature or energy required for the dissociation of A-T nucleotides and G-C nucleotides.
Cheers
Reply
At point 9; Didn’t you mean that primer have should end with “G or C” instead of “C or A”. If not, please explain base of your statement.
With best regards, Thank you
Reply
dreda reply on December 17th, 2008 9:39 am:
Hi matushiq,
Actually the “C or A” at the end is correct. You generally want your primer to be G-C rich because it’s a stronger bond, but at the 3′-end specifically, if you end in C or A, you reduce wobble and increase specificity. I hope this helps.
Daniel
Reply
hi dr…
do u have any suggestion on how to calculate or there is a formula to calculate the specificity of the allele specific primers…?
i mean, as we know, 3-5 nucleotide towards the 3′end of the primers will be the best choice in designing allele specific primer, but how can we know the specific location for our gene?is it 2nd location,3rd, 4th or 5th?
Reply
oh…sorry…
i forgot to say thanks a lot!
i really appreciate if u can email me the answer as soon as possible…
thanks and have a nice day!!
Reply
Add A Comment