Comments on: 10 Tips For Designing PCR Primers That Work

By: mareen

mareen — Tue, 06 Jan 2009 10:42:28 +0000

oh…sorry…

i forgot to say thanks a lot!

i really appreciate if u can email me the answer as soon as possible…

thanks and have a nice day!!

By: mareen

mareen — Tue, 06 Jan 2009 10:35:34 +0000

hi dr…

do u have any suggestion on how to calculate or there is a formula to calculate the specificity of the allele specific primers…?

i mean, as we know, 3-5 nucleotide towards the 3′end of the primers will be the best choice in designing allele specific primer, but how can we know the specific location for our gene?is it 2nd location,3rd, 4th or 5th?

By: dreda

dreda — Wed, 17 Dec 2008 15:39:21 +0000

Hi matushiq,

Actually the “C or A” at the end is correct. You generally want your primer to be G-C rich because it’s a stronger bond, but at the 3′-end specifically, if you end in C or A, you reduce wobble and increase specificity. I hope this helps.

Daniel

By: matushiq

matushiq — Mon, 15 Dec 2008 13:43:28 +0000

At point 9; Didn’t you mean that primer have should end with “G or C” instead of “C or A”. If not, please explain base of your statement.
With best regards, Thank you

By: Josh

Josh — Wed, 03 Dec 2008 02:33:21 +0000

Im currently using real time pcr to analyse fruit fly samples and wanted to ask if there is a known universal temperature or energy required for the dissociation of A-T nucleotides and G-C nucleotides.
Cheers

By: admin

admin — Tue, 11 Nov 2008 00:26:53 +0000

Hi Mohammed,

I’m not sure if there is a specific type of training that you are looking for but I would recommend that you use online forums in molecular biology to find the help that you need.

MiraiBio has just started a Community and although it is still new, it may be worth a shot to start a thread on this topic in the DNASIS SmartNote General forum:

http://www.miraibio.com/community/viewforum.php?f=43&sid=fbd4e6e18aebe254d17aabeb8c9bae26

I hope this information helps.

By: Mohammed Ajeesh C.P

Mohammed Ajeesh C.P — Fri, 31 Oct 2008 14:28:07 +0000

Interesting………….do anyone give trainings in primer designing?????…Pls let me know.Currently,I work to find alkaline phosphatase domains in Cyanobacterium.

Regards
Mohammed Ajeesh C.P

By: admin

admin — Mon, 27 Oct 2008 23:27:13 +0000

Hi Ehsan,

I apologize but the formatting of your sequence is not correct and it is difficult to tell what region you are interested in.

I would recommend that you sign up for a free DNASIS SmartNote account (http://smartnote.miraibio.com/signup.php), upload your sequence, and run the Primer3 tool.

By: chen

chen — Mon, 27 Oct 2008 13:38:12 +0000

Thanks for the clear and valuable information. I found it’s really helpful.

By: Ehsan

Ehsan — Mon, 27 Oct 2008 10:16:59 +0000

Hi Doctor
In this case for example could you tell me what is the forward and reverse primer for this part of gene ?my mean is that we are going to design primers to amplify the target region (indicated by the asterisks, *).
***************************************************************
5′ ACTCGACCTTCCACGCACTCTAGCTGACATGCGATGCT………. ……… continued

***************************************************
continued …………CCGATTCGACCGTGGCAATCTCAGCACGGCTAGCTATCGATACGCGGACTCTCA 3′

Thanks

By: joelri

joelri — Wed, 15 Oct 2008 04:14:16 +0000

Good & informative.

By: admin

admin — Tue, 07 Oct 2008 17:29:27 +0000

Hi Dr. Nazar, MiraiBio also offers a desktop solution for bioinformatics called DNASIS MAX that is suitable for primer design and even siRNA design. There is a free 31-day trial period and you can find more information on our DNASIS MAX product page.

By: Dr Nazar

Dr Nazar — Tue, 07 Oct 2008 10:02:57 +0000

Thanks for this valuable notes. Is it possible to download a suitable software that commonly used in primers design? if so could you send the site (s).